Supplementary MaterialsData_Sheet_1

Supplementary MaterialsData_Sheet_1. bind to FcRs and inhibit IgG-mediated effector features. Since FLIPr and FLIPr-like have capability of binding to FcRs, this character make FLIPr and FLIPr-like are potential vectors to deliver antigen to DCs via FcRs and enhance immune responses. Therefore, we hypothesized that FLIPr can guide antigen-FLIPr fusion protein to FcRs increasing antigen uptake by APCs and facilitate antigen processing and presentation, then promote antigen-specific immune responses. To test this hypothesis, ovalbumin (OVA) was used as a model antigen. The merit of antigen-FLIPr fusion protein was validated by showing the accessibility to DCs, enhancement of antigen processing and presentation on both MHC class II and class I pathways, and induction of CD8+ T cell-mediated antitumor immunity without exogenous adjuvant formulation. Materials Gonadorelin acetate and Methods Reagents and Antibodies Fluorochrome-conjugated antibodies specific for CD3e (145-2C11: FITC, PerCP-Cy5.5, BV510), CD4 (GK1.5: PerCP), CD8 (53-6.7: APC-Cy7, PerCP), CD11b (M1/70: PE-Cy7, BV421), CD11c (N418: APC-Cy7, BV421), CD19 (1D3: FITC, PE-Cy7), CD27 (LG.7F9: FITC), CD40 (3/23: APC), CD43 (1B11: PE-Cy7), CD127 (A7R34: PerCP-Cy5.5), Ly6C (HK1.4: PE-Cy7), Ly6G (1A8, FITC, BV421), MHCII (AF6-120, PerCP-C5.5), NK1.1 (PK136:FITC, PE), PDCA-1 (JF05-1C2.4.1: PE) were Rabbit Polyclonal to CDKA2 Gonadorelin acetate purchased from Biolegend, eBioSience, and BD. Other stains used were anti-mouse CD16/32 antibody, streptavidin-APC, streptavidin-BV510, streptavidin-alexa568, and streptavidin-alexa647. Live/Dead Fixable Green Dead Staining kit, for 488 nm excitation was purchased from Invitrogen and applied for flow cytometry discrimination of live and dead cells. Construction of Expression Vectors Based on the amino acid sequence of OVA (accession number P0102) and FLIPr (accession number “type”:”entrez-protein”,”attrs”:”text”:”BAB57318″,”term_id”:”14246926″,”term_text”:”BAB57318″BAB57318), the DNA sequence encoding OVA-FLIPr were optimized for codon usage and fully synthesized by Genomics Co. (New Taipei City, Taiwan). OVA-FLIPr DNA contained a linker sequence, encoding 4 glycines and 1 serine residue with three repeats (GGGGS)3, between OVA and FLIPr. The forward primer (5- GGAATTCCATATGGGCAGCATTGGCGCGGCGAGCAT?3, NdeI site is underlined) combined with reverse primer (5- CACGAGCTCGAGATCCCAATAAATGCTATC 3?3, BL21 (DE3) (Invitrogen, Carlsbad, CA) was transformed with pOVA-FLIPr. The transformed cells were cultured at 37C overnight. One 6-ml of the overnight culture was scaled up to 600 ml in a 2 L-shake flask and incubated at 37C for 2.5 h before induction. Protein expression was induced (OD600 = 0.5) with the addition of 1 mM IPTG, accompanied by incubation at 37C for 3 h. rOVA-FLIPr was purified by disrupting the gathered cells inside a French press (Regular Systems, Daventry, UK) at 25 Kpsi in homogenization buffer [20 mM Tris (pH 8.0), 40 mM sucrose, 400 mM NaCl and 10% glycerol]. The cell lysate was clarified by centrifugation (32,000 rpm for 40 min). A lot of the rOVA-FLIPr was within inclusion physiques. rOVA-FLIPr Gonadorelin acetate was after that solubilized with removal buffer [20 mM Tris (pH 8.9), 40 mM sucrose, 400 NaCl mM, 10% glycerol, 20 mM Immidazole, and 6M guanidine hydrochloride]. The extracted small fraction was packed onto immobilized metallic Gonadorelin acetate affinity chromatography (IMAC) columns (BIO-RAD, Hercules, CA, USA, 2.5 cm i.d. 10.0 cm) containing 20 ml Ni-NTA resin (Qiagen, NORTH PARK, CA, USA) to purify rOVA-FLIPr. The column cleaned using the extraction buffer as well as the same buffer including 40 mM imidazole, and washed having a 100-fold column level of 10 mM Na2HPO4 and 0.4 M NaCl containing 0.1% Triton X-114 to eliminate the LPS. Next, the column was cleaned without 0.1% Triton X-114 to eliminate the rest of the detergent, and rOVA-FLIPr was eluted with 10 mM Na2HPO4 containing 500 mM imidazole. The eluted rOVA-FLIPr was dialyzed to 10 mM Na2HPO4 3 x for at least 6 h every time. The endotoxin degrees of the purified rOVA-FLIPr had been dependant on the Limulus amebocyte lysate (LAL) assay (Affiliates of Cape Cod, Inc., Cape Cod, MA), as well as the ensuing endotoxin levels had been 10 European union/mg. After dialysis against 50 mM Ammonia bicarbonate pH 8.0, the rOVA-FLIPr was stored and lyophilized in ?20C. The fractions from each stage had been examined by SDS-PAGE and immunoblotted with anti-His-tag antibodies. Planning of rOVA was referred to before (19). FACS Evaluation and Cell Sorting Antibody staining accompanied by movement cytometry was performed to investigate cell surface area marker manifestation. FACS buffer (PBS, 1%FBS, 1 mm EDTA, and 0.1% Sodium azide) was found in all FACS measures. nonspecific antibody binding via Fc receptors was clogged by cell staining with anti-mouse Compact disc16/32 antibody at 4C for 15 min. Within the first staining.