and G

and G. chronic inflammatory disease marked by hyperplasia of the synovial membrane and destruction of the extracellular matrix by the synovium. The invasive properties of rheumatoid granulation tissue (ie, pannus) and fibroblast-like synoviocytes (FLS) have led to the idea that partial transformation of synoviocytes contributes to the pathogenesis of RA. This hypothesis is usually supported by several characteristics of FLS, including anchorage-independent growth and the loss of contact inhibition by cultured FLS, increased telomerase Tiglyl carnitine activity in RA synovium, and oligoclonal growth of FLS at sites of KIT bone and cartilage erosions. 1,2 Tiglyl carnitine The most persuasive evidence supporting this idea is the observation that RA FLS invade normal cartilage co-implanted into SCID mice whereas normal and osteoarthritis FLS do not. 3 Hence, rheumatoid synoviocytes are altered or transformed by their exposure to the inflammatory microenvironment, and these changes are major contributors to the destructive phase of the disease. The mechanism of abnormal synoviocyte biology in RA might be because, in part, of the presence of somatic mutations of the p53 gene in human RA synovium and cultured synoviocytes. 4-6 These mutations can be dominant-negative, indicating that there is loss of p53 function in these RA cells. 7 The tumor suppressor gene p53 has well-established functions in cell-cycle control and apoptosis in response to DNA damage. 8 Such damage is found in rheumatoid synovium, 9 perhaps as a consequence of reactive oxygen and nitric oxide produced during inflammation. At the same time, p53 expression is increased in rheumatoid synovium. 10 Overexpression of p53 in inflammation is not unique to RA and is now known to occur in many other inflammatory conditions. 11 However, previous studies have not considered the function of p53 under these circumstances beyond its well-described response to DNA damage. We, therefore, hypothesized that p53 is an important homeostatic protein that has anti-inflammatory effects and that its expression will serve to down-regulate inflammation. To address this question, we examined the course of collagen-induced arthritis (CIA) in DBA/1 mice with homozygous disruption of the p53 gene. These studies showed that inflammatory arthritis was significantly greater in the p53?/? mice than in mice with functional p53 genes. The mechanism was related to decreased apoptosis along with enhanced synovial expression of cytokines and matrix metalloproteinases (MMPs). Materials and Methods Animals p53?/?DBA/1 mice were Tiglyl carnitine generated by successive backcrosses (more than eight) of male p53?/? B6.129S2-Trp53tm1Tyj (Jackson Laboratory, Bar Harbor, ME) female DBA1. Most mice were used Tiglyl carnitine after the ninth to tenth generation of backcrossing. Genotypes were determined by polymerase chain reaction analysis of genomic DNA isolated from tail samples using the following three primers: x6.5 (ACAGCGTGGTGGTACCTTAT); x7 (TATACTCAGAGCCGCCT); and neo (CTATCAGGACATAGCGTTGG). Targeted mutation (knockout) alleles were identified by a 575-bp polymerase chain reaction product, whereas wild-type alleles gave rise to a 375-bp product. p53+/? DBA/1 or p53?/? males were bred with DBA/1p53+/? females to yield p53+/+ DBA/1, p53+/?, and p53?/? for the experiments explained. To verify that this backcrossed mice were congenic at another locus, peripheral blood mononuclear cells were evaluated by fluorescence-activated cell sorting analysis using anti-I-Aq (clone KH116) and anti-I-Ab (clone AF6-120.1) antibodies (BD-PharMingen, La Jolla, CA). All mice (p53+ and p53?/?) were positive for I-Aq and unfavorable for I-Ab. A C57BL/6 control mouse (H2b), unfavorable for I-Aq and positive for I-Ab, was included as a staining control (data not shown). Induction of CIA Mice (6 to 8 8 weeks aged) were immunized at the base of the tail with 0.1 ml of a solution containing bovine type II collagen (1 mg/ml) (Chondrex, Redmond, WA) in total Freunds.